Category: 53838-27-0

On October 15, 1980, Johansen, Jack Taaning; Widmer, Fred published a patent.SDS of cas: 53838-27-0 The title of the patent was Enzymic production of peptides. And the patent contained the following:

Peptides are produced by reacting amino acid esters, peptide esters, depsipeptides, etc., with an amino acid in the presence of carboxypeptidase in an aqueous solution with a pH of 5-10.5. Thus, a valine [72-18-4]-KCl-EDTA solution, pH 9.8, was mixed with a Bz-Ala-OMe [7244-67-9] solution and the reaction carried out in a pH-stat at 35° with the pH maintained by the addition of NaOH. The reaction was initiated by adding carboxypeptidase Y [9046-67-7]. It was stopped after sufficient time by the addition of HCl to lower the pH to 1.0. The reaction product was purified and isolated by high-pressure chromatog. giving a 40% yield of Bz-Ala-Val-OH [71448-06-1]. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).SDS of cas: 53838-27-0

The Article related to peptide production carboxypeptidase, amino acid peptide production enzyme, amide peptide production enzyme, Fermentations: Other and other aspects.SDS of cas: 53838-27-0

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On September 18, 2006, Aagren, Jenny K. M.; Billing, Johan F.; Grundberg, Hans E.; Nilsson, Ulf J. published an article.Synthetic Route of 53838-27-0 The title of the article was Synthesis of a chiral and fluorescent sugar-based macrocycle by 1,3-dipolar cycloaddition. And the article contained the following:

An efficient and modular synthesis of a chiral, amphiphilic, and fluorescent macrocycle is described. A bis-acetylene was prepared by coupling the amino group of a sugar δ-amino acid with a glutamic acid propargylic amide derivative, followed by coupling of the sugar δ-amino acid carboxy group with a glutamic acid propiolyl amide. The bis-acetylene was reacted with 9,10-bis(azidomethyl)anthracene under Cu(I) catalysis to afford the target fluorescent macrocycle. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).Synthetic Route of 53838-27-0

The Article related to amphiphilic fluorescent glycoside macrocycle preparation dipolar cycloaddition, Carbohydrates: Amines and other aspects.Synthetic Route of 53838-27-0

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On July 1, 1997, Baker, Brenda F. published a patent.Application of 53838-27-0 The title of the patent was Compositions and methods for modulating RNA activity through modification of the 5′ cap structure of RNA. And the patent contained the following:

Methods for regulating gene expression in biol. exptl. systems via modification or removal of the 5′ cap structure of targeted RNAs are disclosed. Modification or removal of the 5′ cap structure is achieved in accordance with preferred embodiments utilizing antisense compounds which are complementary to the 5′ terminus of the targeted RNA and have attached to them reactive moieties explicitly designed for chem. modification or cleavage of the 5′ cap structure of RNA. Thus, the 5′ capped RNA target m7GpppGAGCUCCUCUGCUACUCAGA32pCp and the antisense oligodeoxyribonucleotide TCTGAGTAGCAGAGGAGCTCGGT were synthesized; reactive moieties such as Cu(II)-N-(2-mercaptoacetyl)glutamine or Cu(II)-N-(2-mercaptopropionyl)glycine were tethered to the 3′-terminus of the antisense oligonucleotide. The antisense oligonucleotide inhibits complexation of eukaryotic initiation factor 4E protein to the mRNA target by cleaving the 5′-cap. Other tethered mols. were also found to inhibit gene expression at the mRNA level, such as alkyl amines (triethylene tetramine), aromatic amines (imidazole), and lanthanide metal coordination complexes (Eu:DTPA-dien). Compositions that have utility as research reagents and therapeutics for the treatment of diseases are disclosed. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).Application of 53838-27-0

The Article related to gene expression regulation mrna cap modification, mrna cap modification oligonucleotide probe, Biochemical Genetics: Methods and other aspects.Application of 53838-27-0

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On November 7, 1997, Plummer, Mark S.; Holland, Debra R.; Shahripour, Aurash; Lunney, Elizabeth A.; Fergus, James H.; Marks, James S.; McConnell, Patrick; Mueller, W. Thomas; Sawyer, Tomi K. published an article.Formula: C10H19NO4 The title of the article was Design, Synthesis, and Cocrystal Structure of a Nonpeptide Src SH2 Domain Ligand. And the article contained the following:

The specific association of an SH2 domain with a phosphotyrosine (pTyr)-containing sequence of another protein precipitates a cascade of intracellular mol. interactions (signals) which effect a wide range of intracellular processes. The nonreceptor tyrosine kinase Src, which has been associated with breast cancer and osteoporosis, contains an SH2 domain. Inhibition of Src SH2-phosphoprotein interactions by small mols. will aid biol. proof-of-concept studies which may lead to the development of novel therapeutic agents. Structure-based design efforts have focused on reducing the size and charge of Src SH2 ligands while increasing their ability to penetrate cells and reach the intracellular Src SH2 domain target. In this report we describe the synthesis, binding affinity, and Src SH2 cocrystal structure of a small, novel, nonpeptide, urea-containing SH2 domain ligand. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).Formula: C10H19NO4

The Article related to src sh2 domain nonpeptide ligand preparation, Pharmacology: Structure-Activity and other aspects.Formula: C10H19NO4

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On June 18, 1996, Klein, Scott; Molino, Bruce F.; Czekaj, Mark; Dener, Jeffrey S.; Leadley, Robert J.; Sabatino, Ralph; Dunwiddie, Christopher T.; Chu, Valeria published an article.HPLC of Formula: 53838-27-0 The title of the article was Non-peptide fibrinogen receptor antagonists based upon a 4-substituted piperidine scaffold. And the article contained the following:

Structure-activity relationships developed from work with peptide based fibrinogen receptor antagonists have been successfully applied to the development of simple and highly potent nonpeptide agents of the same class. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).HPLC of Formula: 53838-27-0

The Article related to fibrinogen receptor antagonist trimethylene dipiperidine derivative, Pharmacology: Structure-Activity and other aspects.HPLC of Formula: 53838-27-0

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On March 11, 2010, Jarvis, Ashley; Allerston, Charles K.; Jia, Haiyan; Herzog, Birger; Garza-Garcia, Acely; Winfield, Natalie; Ellard, Katie; Aqil, Rehan; Lynch, Rosemary; Chapman, Chris; Hartzoulakis, Basil; Nally, James; Stewart, Mark; Cheng, Lili; Menon, Malini; Tickner, Michelle; Djordjevic, Snezana; Driscoll, Paul C.; Zachary, Ian; Selwood, David L. published an article.Reference of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate The title of the article was Small Molecule Inhibitors of the Neuropilin-1 Vascular Endothelial Growth Factor A (VEGF-A) Interaction. And the article contained the following:

We report the mol. design and synthesis of EG00229, 2, the first small mol. ligand for the VEGF-A receptor neuropilin 1 (NRP1) and the structural characterization of NRP1-ligand complexes by NMR spectroscopy and X-ray crystallog. Mutagenesis studies localized VEGF-A binding in the NRP1 b1 domain and a peptide fragment of VEGF-A was shown to bind at the same site by NMR, providing the basis for small mol. design. Compound 2 demonstrated inhibition of VEGF-A binding to NRP1 and attenuated VEGFR2 phosphorylation in endothelial cells. Inhibition of migration of endothelial cells was also observed The viability of A549 lung carcinoma cells was reduced by 2, and it increased the potency of the cytotoxic agents paclitaxel and 5-fluorouracil when given in combination. These studies provide the basis for design of specific small mol. inhibitors of ligand binding to NRP1. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).Reference of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate

The Article related to neuropilin vegf inhibitor design antitumor combination chemotherapy, Pharmacology: Structure-Activity and other aspects.Reference of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

Lebrun, M. H.; Nicolas, L.; Boutar, M.; Gaudemer, F.; Ranomenjanahary, S.; Gaudemer, A. published an article in 1988, the title of the article was Relationships between the structure and the phytotoxicity of the fungal toxin tenuazonic acid.HPLC of Formula: 53838-27-0 And the article contains the following content:

Tenuazonic acid (I) is a metabolite produced by the fungal pathogen of rice Pyricularia oryzae. It inhibits growth of plants by interfering with protein synthesis at the ribosome level. I with substituents at C3 and C5 were prepared Substituents at C5 other than sec-Bu or Pr, decrease the phytotoxicity of the analogs. But substitutions at C-3 abolish the toxicity. Thus, I seems to have the optimal structure for phytotoxicity. I induces rice leaf defense reactions (browning) of reactive varieties which are resistant to P. oryzae. Some of the analogs synthesized have a low level of phytotoxicity and are able to induce this leaf browning of the reactive rice varieties. Thus different structural features are required for phytotoxicity and for leaf browning. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).HPLC of Formula: 53838-27-0

The Article related to phytotoxicity tenuazonic acid analog, leaf rice phytotoxicity tenuazonate analog, root rice phytotoxicity tenuazonate analog, Toxicology: Venoms, Toxins, and Poisons and other aspects.HPLC of Formula: 53838-27-0

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On October 15, 2006, Tao, Haiyan; Peralta-Yahya, Pamela; Lin, Hening; Cornish, Virginia W. published an article.Name: (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate The title of the article was Optimized design and synthesis of chemical dimerizer substrates for detection of glycosynthase activity via chemical complementation. And the article contained the following:

Glycosynthases catalyze the formation of a glycosidic bond between a glycosyl fluoride donor substrate and a glycosyl acceptor substrate with high yield, thus providing a valuable approach for the synthesis of carbohydrates and glycoconjugates. Chem. complementation can be used to link glycosynthase activity to the transcription of a reporter gene in vivo, providing a selection for the directed evolution of glycosynthase enzymes with improved properties. In this approach, glycosynthase activity is detected as covalent coupling between a small mol. disaccharide acceptor substrate and a small mol. disaccharide α-fluoro donor substrate. Here the authors report the optimized design and synthesis of these small mol. substrates. These optimized substrates are shown to give a robust, glycosynthase-dependent transcriptional read-out in the chem. complementation assay. The full synthesis and characterization of these substrates are reported for the first time. These optimized chem. dimerizer substrates should allow the potential of chem. complementation for the directed evolution of glycosynthases with diverse substrate specificities and improved properties to be fully realized. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).Name: (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate

The Article related to glycosynthase substrate design preparation, Enzymes: Analysis (Determination-Detection) and other aspects.Name: (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On June 30, 2006, Balakrishnan, Anand; Wring, Stephen A.; Coop, Andrew; Polli, James E. published an article.HPLC of Formula: 53838-27-0 The title of the article was Influence of Charge and Steric Bulk in the C-24 Region on the Interaction of Bile Acids with Human Apical Sodium-Dependent Bile Acid Transporter. And the article contained the following:

The human apical sodium-dependent bile acid transporter (hASBT) is a potential target for drug delivery, but an understanding of hASBT substrate requirements is limited. The objective of this study was to evaluate the influence of ionic character and steric bulk in the C-24 region of bile acid conjugates in governing interaction with hASBT. Ionic character was studied using chenodeoxycholate (CDCA) conjugates of glutamic acid and lysine, which varied in charge (mono-anionic, di-anionic, cationic, neutral, and zwitterionic) and location of charge (proximal or distal to C-24). Steric effects were evaluated using ester conjugates that varied in ester substituent size (Me, benzyl, and tert-butyl) and location (proximal and/or distal). Conjugate interaction with hASBT was assessed via transport and inhibition studies, using a hASBT-MDCK monolayer. Mono-anionic, cationic, and neutral conjugates of CDCA exhibited high inhibitory potency (Ki < 10 μM). High inhibition potency of neutral and cationic conjugates indicated that a neg. charge is not essential for hASBT binding. Di-anionic conjugates exhibited low inhibition potency (Ki > 100 μM). Conjugates with a single bulky ester substituent proximal or distal to the C-24 region exhibited high inhibition potency. However, two bulky substituents practically abolished interaction. In transport studies, mono-anionic conjugates were high affinity hASBT substrates. Meanwhile, cationic and zwitterionic conjugates were not substrates for hASBT. Overall, C-24 ionic character influenced interaction with hASBT. Although the presence of a single neg. charge was not essential for interaction with hASBT, mono-anionic conjugates were favored for hASBT-mediated transport compared to cationic and zwitterionic conjugates. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).HPLC of Formula: 53838-27-0

The Article related to apical sodium dependent bile acid transporter electrostatic steric effect, asbt protein transport bile acid conjugate electrostatic steric effect, General Biochemistry: Subcellular Processes and other aspects.HPLC of Formula: 53838-27-0

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

Krabill, Aaron D.; Chen, Hao; Hussain, Sajjad; Hewitt, Chad S.; Imhoff, Ryan D.; Muli, Christine S.; Das, Chittaranjan; Galardy, Paul J.; Wendt, Michael K.; Flaherty, Daniel P. published an article in 2021, the title of the article was Optimization and anti-cancer properties of fluoromethylketones as covalent inhibitors for ubiquitin C-terminal hydrolase L1.Category: esters-buliding-blocks And the article contains the following content:

The deubiquitinating enzyme (DUB) UCHL1 is implicated in various disease states including neurodegenerative disease and cancer. However, there is a lack of quality probe mols. to gain a better understanding on UCHL1 biol. To this end a study was carried out to fully characterize and optimize the irreversible covalent UCHL1 inhibitor VAEFMK. Structure-activity relationship studies identified modifications to improve activity vs. the target and a full cellular characterization was carried out for the first time with this scaffold. The studies produced a new inhibitor, 34, with an IC50 value of 7.7 μM against UCHL1 and no observable activity vs. the closest related DUB UCHL3. The mol. was also capable of selectively inhibiting UCHL1 in cells and did not demonstrate any discernible off-target toxicity. Finally, the mol. was used for initial probe studies to assess the role of UCHL1 role in proliferation of myeloma cells and migration behavior in small cell lung cancer cells making 34 a new tool to be used in the biol. evaluation of UCHL1. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).Category: esters-buliding-blocks

The Article related to uchl fluoromethylketone covalent inhibitor optimization anticancer property, uchl1 inhibitors, covalent inhibitors, deubiquitinases, fluoromethylketones, Placeholder for records without volume info and other aspects.Category: esters-buliding-blocks

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics