On July 1, 1997, Baker, Brenda F. published a patent.Application of 53838-27-0 The title of the patent was Compositions and methods for modulating RNA activity through modification of the 5′ cap structure of RNA. And the patent contained the following:
Methods for regulating gene expression in biol. exptl. systems via modification or removal of the 5′ cap structure of targeted RNAs are disclosed. Modification or removal of the 5′ cap structure is achieved in accordance with preferred embodiments utilizing antisense compounds which are complementary to the 5′ terminus of the targeted RNA and have attached to them reactive moieties explicitly designed for chem. modification or cleavage of the 5′ cap structure of RNA. Thus, the 5′ capped RNA target m7GpppGAGCUCCUCUGCUACUCAGA32pCp and the antisense oligodeoxyribonucleotide TCTGAGTAGCAGAGGAGCTCGGT were synthesized; reactive moieties such as Cu(II)-N-(2-mercaptoacetyl)glutamine or Cu(II)-N-(2-mercaptopropionyl)glycine were tethered to the 3′-terminus of the antisense oligonucleotide. The antisense oligonucleotide inhibits complexation of eukaryotic initiation factor 4E protein to the mRNA target by cleaving the 5′-cap. Other tethered mols. were also found to inhibit gene expression at the mRNA level, such as alkyl amines (triethylene tetramine), aromatic amines (imidazole), and lanthanide metal coordination complexes (Eu:DTPA-dien). Compositions that have utility as research reagents and therapeutics for the treatment of diseases are disclosed. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).Application of 53838-27-0
The Article related to gene expression regulation mrna cap modification, mrna cap modification oligonucleotide probe, Biochemical Genetics: Methods and other aspects.Application of 53838-27-0
Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics